Marker Overview
NameB08_24623935
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B08 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B08_24623935 ID=B08_24623935|Name=B08_24623935|organism=Arachis spp.|type=SNP
TTCTTTATCACAAAAGATTATGTCACCTTCCAAATTTTGCACCTAAAGACAAGAAACATCTTCTTGGCATACCTTTTACT
GTTCGTGAGACTTAAATTCATCTTCTTCTTACCAGTGCGGAATTATTTCATCTTTTAAGTTTTGCATCTAAAAACAAAGT
GCAACTTCTTCATAGACCTCTGGTTGTTCATAAAGCTCAT[C/A]TCTATCTACTTCACTTTTCAAGGTATGTTTCATAT
ACTAGCCATATACATTTGAACCATTAATTCTGATATATTGTTTCATAAAGGAATATTCTTATTTTACTCATCTCGTCACT
ATACATTTCACCATAGCCACTAGCAGCAACCCTTCTCCTTCCACAAAAGAAAAAAGAAACCATGGAGAAAATCCCCATGC
ATAAA
Marker Positions
NameB08_24623935
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.18 26199229 26199629 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B08position: 24.51cM [CMap]