Marker Overview
NameB08_25059323
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B08 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B08_25059323 ID=B08_25059323|Name=B08_25059323|organism=Arachis spp.|type=SNP
ACAAGAACTTTGGCATACTGATAAGATGAGATCATTTATATATTTTATTTGTATTCATTTTACTCTCTTCTGTTAAGGTT
ATGCACATTTTTCTACCTTTAAACGAGGTGTGAGATTTTTATATTTACATAAGACGAGTCTTAAAATATTAGATGTTCAC
GTATGGCGTTGTGGTTGTGTGGTATGAGATATTCCGCTCT[C/T]TTCAACCGTTTAGATATAATTTAAAAGGGATAAGG
ATTGTTTTGGTTAATCCCCAACGAGCCACCGCGACCACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCACCGAACAGCCGCCGTGCCTCTCAGTGACGGCGTTGCTACCCAA
CCTTT
Marker Positions
NameB08_25059323
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.18 26667925 26668200 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B08position: 27.27cM [CMap]