Marker Overview
NameB08_26202335
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B08 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B08_26202335 ID=B08_26202335|Name=B08_26202335|organism=Arachis spp.|type=SNP
TGTTCTTCAAAGTGGTTCTAGGTTTTACTGTTCTTCTTGTTCTAGTTCTTCTCGTAATTGATTTTTCGCTGTATATTGCT
TAATTTATTGGGTGTATATGGAGTAATTTGTATGGGTGTATATGGTTGATTGTTGGGTGTATATGGCGTAATGTGTTGGG
TGTATATATGGTTGATTGTTGGGTGTATACGGCGTAATTT[G/A]TTAGGTGTATACGGCGTAATTTGTTGGGTGTATAT
TCCTGAACCCATATCATGTAATATAATCAACTGTTGCAACTGTTCTAATATTGCTTGTCCTTGGGTGTATATTGCTTGAC
ATTGTAATATTGCTAGAGCTTGTATATTTATCGTTGTTTGAGTCAATTGAACATCATTTTGAACTGATCTCATTAAATAC
TTATA
Marker Positions
NameB08_26202335
Physical position(s)physical position unknown
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B08position: 25.82cM [CMap]