Marker Overview
NameB08_27287654
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B08 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length105bp
Sequence
>B08_27287654 ID=B08_27287654|Name=B08_27287654|organism=Arachis spp.|type=SNP
CTCCATGGTGATGGTAGCAGCAAGCTCGATGGCAGCACCCAGGCACGACG[A/G]CAGCAACAGTAGGACACGGTACTGC
GGAGATGACTGGGCATGGTCTCCCC
Marker Positions
NameB08_27287654
Physical position(s)physical position unknown
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B08position: 27.27cM [CMap]