Marker Overview
NameB08_30205406
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-A07 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B08_30205406 ID=B08_30205406|Name=B08_30205406|organism=Arachis spp.|type=SNP
AGCCACGGTGGCACCGAAAACCACAAACGACGGTGGTGGAACTGTTGAAGAAGCTAGGGTTTTGGTTTTAGGTTTTTGAA
CTTTGAAGAAGGGTTTTAGTTCTTTGTTGAATGCTGAGTGACAAAATGCACGAAGGAGGGGGGTCGGGGGAAGGGGACGT
GACTCACGCGTGGGGTTTCTTTTTTTAAAATCAAGGAAAA[C/T]GGCGTCATTTATAAAAAATTGGCCAATTTCTGGTC
CGGTCCAACCGGACGGTTCGACGATTTTTAGGTGGTTCTCCAATTGGCGGTTTTAGACATAGGACTAGACCGTTGTCATC
GTTGGTTTCTAGTTGGACCGATTCGATCAGCCGGCCGACTTTTAAAACCATGATAATGATACAAATATATAATAACTAGG
ATGCT
Marker Positions
NameB08_30205406
Physical position(s)physical position unknown
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-A07position: 112.3cM [CMap]