Marker Overview
NameB08_41269734
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B02 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B08_41269734 ID=B08_41269734|Name=B08_41269734|organism=Arachis spp.|type=SNP
ATAACAGATCTGATAGAACACCACCGAACATCAAGAACAGCTTCAGACTCAAACGGGAGAAGNNNNNNNNNNNNNNNNNN
NNNNNGGACCAGCGAAGAACCTCACCGAAGACGACGACGACAGCGAGCACGAGGCCTTGCAAAAGAATATGAGTGACACC
CAGAAAAGAGAAGCCTGATCGGAGACGACACCAAACGCAG[A/C]ACCAAATCTGACGAAAGAAAAGTAATAAAACCAGA
TCTCAAGTCCAAGAGGCACGCTTGAATTACTAGGAACCACGTTGGGTTGAACAAGGGTTTAATAATTTATTATTGCTGTA
GGGATACATGGGGAAAGAAAAATTTCGTACGTAGTCGAGGTAGTATTGAATTATTGGGTTATTGGGTTACGGACTTAACG
TTACG
Marker Positions
NameB08_41269734
Physical position(s)physical position unknown
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B02position: 52.47cM [CMap]