Marker Overview
NameB10_5650553
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-A10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_5650553 ID=B10_5650553|Name=B10_5650553|organism=Arachis spp.|type=SNP
GCAAGAAGGTGAGAGAAACTATGCTCCTATATTTTAGTAATGAAAGAAAAATATTAGATAATAAATATTTTATTGTATTT
AATTTCATTAGGGAATCAATTAAGAGAGAAGCGAACTCTAGTCAACTAATTAAAAAATAGATATGTTACAAAAAAAATTT
TTCTACTATCCTAATTTTTCGAATTTTAAAATGTTACAAC[C/T]TAAAATGAGTCATAATTGATGTTTGGAAAAATAAT
CCCCTAACAAGTCTAATAGATTCGAATATAAATTAAATAAAAAAGTTACAAGTATTTTTAATGAATTTACAAGTTCTAGA
ATGAATGGTTACACATTTTTAACAAAAAGATAAAATAAATAAATATAGTTGGATCCTGCCTGTGACATATGGTGCATATA
ATGTC
Marker Positions
NameB10_5650553
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.20 5821349 5821749 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-A10position: 95.33cM [CMap]