Marker Overview
NameB10_5828366
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-A10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_5828366 ID=B10_5828366|Name=B10_5828366|organism=Arachis spp.|type=SNP
TTCTGCCACCGCTGAGGAACCACTCGCCATTAGAACCGTCACTGCGTGTTGTGTTCCGTCACCGCCGCCACGCCGTGTCC
CCGTCGCCACCACCCGAAGGCTCTAGCGCTGCCGCTGCTACTATAGCCGCCATCATCTGTTGCATGTGCGAAAGGAGAGA
GGGGCCTTGAGAACAAGGAAAGGAGTCGTGTGAGGCTTGT[G/C]CCGAGAGGCAGAGGGCTGTTCAGCCGCCACCGCTG
CTGCCATGATCACCGGTTTCAAAAAAAAGGGGATGCCGTCGAAGTACCTCTGATATGGTCTAGATCCCTTCCTCTAATTT
GCTCTGTTTCCATTCTTGCTCTGCTGCTATTTCATTTGTTACCCTATTCTCGTTTTATTTCATTTCAGCCCCTACAGCTA
TGATT
Marker Positions
NameB10_5828366
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.20 6015522 6015922 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-A10position: 95.33cM [CMap]