Marker Overview
NameB10_85451252
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_85451252 ID=B10_85451252|Name=B10_85451252|organism=Arachis spp.|type=SNP
GAGGATCCTGAATTGGATTCAAAGGGGAAGATCTGAATAAGCATTTGGATTGAGAGAGAATGGTGTAGAGAGCGAGGAAA
AGAGTTGTGAAGAGGTATAACAGAGAAAAACAGAGGAGCTTGGATTGGAAGATTAGAGGTTTGGTAGTGGTAAAGCCATT
TTTGATGTGTTTTGATGTGAGAATGCAGACAATAACTTGT[G/A]TCTTTGCTAGCTGCAAGCCTTCCAGGCAATGCTAC
TTTCTTCTTGACCTATGTGGCTCTCAAGTAAGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTGGCAA
TGCTGATTAAGTTTGTTTGTTATATATGCTAAAGGGTGCATTAATGCAAACTTGATTTACAAATGGTGTTTCCATGATCT
TGTTA
Marker Positions
NameB10_85451252
Physical position(s)physical position unknown
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B10position: 103.66cM [CMap]