Marker Overview
NameB10_89912142
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_89912142 ID=B10_89912142|Name=B10_89912142|organism=Arachis spp.|type=SNP
TGTGCAAAAGGTCTAACAGACCTTGAAAGGAGATAATTAATATAGCAAATGAGAATGAAGTGATGAAGGAAATAACTATA
GAAGGGTGAAAAAAAGTATATTGGAGATGAAAAAAAAATAGATTTTGAAAGGATCATTGAACAGGGGGATAAAAAACTAA
AAGAAAAATTTGGTAGGCTATTCAAAAATTCAAATAATAA[A/T]AAAAAAAAAGTGTCGTTGATGAATGCGGGTCGTGA
TCTGGTATGATGTGGGTGTGGAACTTTACATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
Marker Positions
NameB10_89912142
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.20 45391559 45391826 [GBrowse]
arahy.Tifrunner.gnm1 arahy.Arahy.20 45391559 45391826 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B10position: 104.3cM [CMap]