Marker Overview
NameB10_90929906
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_90929906 ID=B10_90929906|Name=B10_90929906|organism=Arachis spp.|type=SNP
GATCATGCTTTGCTTTGTTACATGCAACTGGTGATAAATTTCATTATAGCAGAGAAATTATTCAGTCTCCATTTATTTAT
TTATTATCATATTATATATCACTTTTACAGTTTTACAGCTTTTTTTTTAATCTGAAAAGTTATTATTAAGTCAATTCTAT
AGTGTCTATTATTTAAAAATTATTTATTTTATTCTTTAGT[C/A]GCTCATTTACTTATTTATTTATACTTATTTGTCTA
TTTTAGATGAATACGGAGCTAGTACACACCTTCATTTATTAGTGAAGGATGTGCATAATTTGCTAGAAGGTTTGTGCATA
GTTGTCACTTTTGATAAACATCATGCAGCAATAGGAGAAGTAGCTGGACTCCTTGCAGGAGTTTGTGGGCAATTGGCCAC
TGATT
Marker Positions
NameB10_90929906
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.20 96727301 96727701 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B10position: 103.66cM [CMap]