Marker Overview
NameB10_98465132
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source DescriptionGenomic DNA
Genetic Map(s)
TT_Tifrunner_x_GT-C20_c [CMap] linkage group: TT_Tifrunner_x_GT-C20_c-B10 [CMap]
Publication(s)Primary: Agarwal, Clevenger et al., 2018a
Sequence length405bp
Sequence
>B10_98465132 ID=B10_98465132|Name=B10_98465132|organism=Arachis spp.|type=SNP
AGGAAGTTGAGGCTGATGGCAAAACTGCCTCCAAGGGAATGGGGAAAATTTTAACAATGTTTACTAACTATTTAAAATGT
TAGCTGGTTAATGTAGATCTAGTTTGATCATACTATATGATTGTGAGATTTCATTTTGATTGGAACTTATTACATACTCT
TTATGCCTTAGGTTGTGTAAAAGTGAACAGAATTACTGCT[G/A]TTTTGATATAAGTCCAAGTGTCATCTGGTTTCATG
AATGCTTTAAGACTATTAACCTTGGCTTGTTAATGAATGAAGTCACATGGTTATGTTTTGGTTTATCTGTTTCTGCTTTC
ATTCTTATGTTGTGCAAGTAATCTATACTACATGTTATGCATTAGTAAAACAGACACAAATATTCAGTCATATTTCATCT
CAACC
Marker Positions
NameB10_98465132
Physical position(s)
Assembly version Chromosome Start End View Position
arahy.Tifrunner.gnm1 arahy.Arahy.20 104258150 104258550 [GBrowse]
Map Position(s)
map: TT_Tifrunner_x_GT-C20_clinkage group: TT_Tifrunner_x_GT-C20_c-B10position: 100.17cM [CMap]