Marker Overview
NameDS_c1614_886_A02_88903581
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source Description
Primer1 Sequence
>DS_c1614_886_A02_88903581_Fwd_FAM
GAAGGTGACCAAGTTCATGCTCAGATACAGTGACAGATATGAATGGTG
Primer2 Sequence
>DS_c1614_886_A02_88903581_Fwd_VIC
GAAGGTCGGAGTCAACGGATTTCAGATACAGTGACAGATATGAATGGTA
Primer3 Sequence
>DS_c1614_886_A02_88903581_Rev
AGCTGAGGAGAACCCCTTTT
Genetic Map(s)This marker has not been placed on any genetic maps
Publication(s)Primary: Leal-Bertioli, Moretzsohn et al., 2016a
CommentsThe PCR amplification pattern for Arachis duranensis was not equivalent to the identical one exhibited by A. stenosperma, (A. batizocoi x A. stenosperma)4x, (A. gregoryi x A. stenosperma)4x, A. hypogaea, and A. monticola. DS_c1614_886_A02_88903581_Rev is an allele flanking reverse primer, DS_c1614_886_A02_88903581_Fwd_FAM is an allele-specific forward primer that detects SNP allele G, and DS_c1614_886_A02_88903581_Fwd_VIC is an allele-specific forward primer that detects SNP allele A. The SNP is specifically a Single Nucleotide Polymorphism Kompetitive Allele Specific Polymerase Chain Reaction (SNP-KASP) marker. This marker is associated with the A. stenosperma-derived Root Knot Nematode resistance locus on linkage group A02 and was validated in a tetraploid context. DS_c1614_886_A02_88903581 was developed using information taken from the A. duranensis genome sequence.
Sequenceunknown
Marker Positions
NameDS_c1614_886_A02_88903581
Physical position(s)physical position unknown
Map Position(s)This marker is not placed on any map.