|
|
Marker Overview
| Name | Nem_Aradu.A04_109789467 |
|---|
| Marker Type | SNP |
|---|
| Accession | n/a |
|---|
| Organism | Arachis spp. (multiple peanut species) |
|---|
| Source Description | |
|---|
| Primer1 Sequence | >Nem_Aradu.A04_109789467_Fwd_FAM
GAAGGTGACCAAGTTCATGCTCAATAGAAACAGCAAAGCAATGG |
|---|
| Primer2 Sequence | >Nem_Aradu.A04_109789467_Fwd_VIC
GAAGGTCGGAGTCAACGGATTCAATAGAAACAGCAAAGCAATGA |
|---|
| Primer3 Sequence | >Nem_Aradu.A04_109789467_Rev
CCAAAGCTCTTTTCCAGGTT |
|---|
| Genetic Map(s) | This marker has not been placed on any genetic maps |
|---|
| Publication(s) | Primary: Leal-Bertioli, Moretzsohn et al., 2016a |
|---|
| Comments | The PCR amplification pattern for Arachis stenosperma was not equivalent to the same one exhibited by (A. batizocoi x A. stenosperma)4x and (A. gregoryi x A. stenosperma)4x; neither of these patterns was the same as the identical one exhibited by A. duranensis, A. hypogaea, and A. monticola. Nem_Aradu.A04_109789467_Rev is an allele flanking reverse primer, Nem_Aradu.A04_109789467_Fwd_FAM is an allele-specific forward primer that detects SNP allele A, and Nem_Aradu.A04_109789467_Fwd_VIC is an allele-specific forward primer that detects SNP allele G. The SNP is specifically a Single Nucleotide Polymorphism Kompetitive Allele Specific Polymerase Chain Reaction (SNP-KASP) marker. This marker is associated with the A. stenosperma-derived Root Knot Nematode resistance locus on linkage group A04 and was validated in a tetraploid context. Nem_Aradu.A04_109789467 was developed using information taken from the A. duranensis genome sequence. |
|---|
| |
|---|
| Sequence | unknown |
|---|
Marker Positions
| Name | Nem_Aradu.A04_109789467 |
|---|
| Physical position(s) | physical position unknown |
|---|
| Map Position(s) | This marker is not placed on any map. |
|---|
|
