Marker Overview
NameNem_Aradu.A04_113373632
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source Description
Primer1 Sequence
>Nem_Aradu.A04_113373632_Fwd_FAM
GAAGGTGACCAAGTTCATGCTAGGTTGGTCAAGGGTTTCAG
Primer2 Sequence
>Nem_Aradu.A04_113373632_Fwd_VIC
GAAGGTCGGAGTCAACGGATTAGGTTGGTCAAGGGTTTCAA
Primer3 Sequence
>Nem_Aradu.A04_113373632_Rev
TCCTCATCATCATCTTTCTCCA
Genetic Map(s)This marker has not been placed on any genetic maps
Publication(s)Primary: Leal-Bertioli, Moretzsohn et al., 2016a
CommentsNem_Aradu.A04_113373632_Rev is an allele flanking reverse primer, Nem_Aradu.A04_113373632_Fwd_FAM is an allele-specific forward primer that detects SNP allele A, and Nem_Aradu.A04_113373632_Fwd_VIC is an allele-specific forward primer that detects SNP allele G. The SNP is specifically a Single Nucleotide Polymorphism Kompetitive Allele Specific Polymerase Chain Reaction (SNP-KASP) marker. This marker is associated with the A. stenosperma-derived Root Knot Nematode resistance locus on linkage group A04 and was validated in a tetraploid context. Nem_Aradu.A04_113373632 was developed using information taken from the A. duranensis genome sequence.
Sequenceunknown
Marker Positions
NameNem_Aradu.A04_113373632
Physical position(s)physical position unknown
Map Position(s)This marker is not placed on any map.