|
|
Marker Overview
| Name | TOG894171_695_A02_92486807 |
|---|
| Marker Type | SNP |
|---|
| Accession | n/a |
|---|
| Organism | Arachis spp. (multiple peanut species) |
|---|
| Source Description | |
|---|
| Primer1 Sequence | >TOG894171_695_A02_92486807_Fwd_FAM
GAAGGTGACCAAGTTCATGCTCTAYATTAATCAGGCAATAGCAACA |
|---|
| Primer2 Sequence | >TOG894171_695_A02_92486807_Fwd_VIC
GAAGGTCGGAGTCAACGGATTYATTAATCAGGCAATAGCAACG |
|---|
| Primer3 Sequence | >TOG894171_695_A02_92486807_Rev
CTTCTGTTGGGGTGTTGGAT |
|---|
| Genetic Map(s) | This marker has not been placed on any genetic maps |
|---|
| Publication(s) | Primary: Leal-Bertioli, Moretzsohn et al., 2016a |
|---|
| Comments | The same PCR amplification pattern for Arachis stenosperma, (A. batizocoi x A. stenosperma)4x, and (A. gregoryi x A. stenosperma)4x was not equivalent to the identical one exhibited by A. duranensis, A. hypogaea, and A. monticola. TOG894171_695_A02_92486807_Rev is an allele flanking reverse primer, TOG894171_695_A02_92486807_Fwd_VIC is an allele-specific forward primer that detects SNP allele G, and TOG894171_695_A02_92486807_Fwd_FAM is an allele-specific forward primer that detects SNP allele A. The SNP is specifically a Single Nucleotide Polymorphism Kompetitive Allele Specific Polymerase Chain Reaction (SNP-KASP) marker. This marker is associated with the A. stenosperma-derived Root Knot Nematode resistance locus on linkage group A02 and was validated in a tetraploid context. TOG894171_695_A02_92486807 was developed using information taken from the A. duranensis genome sequence. |
|---|
| |
|---|
| Sequence | unknown |
|---|
Marker Positions
| Name | TOG894171_695_A02_92486807 |
|---|
| Physical position(s) | physical position unknown |
|---|
| Map Position(s) | This marker is not placed on any map. |
|---|
|
