Marker Overview
NameTOG906490_74_A04_106874754
Marker TypeSNP
Accessionn/a
OrganismArachis spp. (multiple peanut species)
Source Description
Primer1 Sequence
>TOG906490_74_A04_106874754_Fwd
TTCATTCCATAAGCCCAACC
Primer2 Sequence
>TOG906490_74_A04_106874754_Rev_FAM
GAAGGTGACCAAGTTCATGCTTTTTCGAATCCTCATATTGCG
Primer3 Sequence
>TOG906490_74_A04_106874754_Rev_VIC
GAAGGTCGGAGTCAACGGATTAACTTTTCGAATCCTCATATTGCT
Genetic Map(s)This marker has not been placed on any genetic maps
Publication(s)Primary: Leal-Bertioli, Moretzsohn et al., 2016a
CommentsThe same PCR amplification pattern for Arachis stenosperma, (A. batizocoi x A. stenosperma)4x, and (A. gregoryi x A. stenosperma)4x was not equivalent to the identical one exhibited by A. duranensis, A. hypogaea, and A. monticola. TOG906490_74_A04_106874754_Fwd is an allele flanking forward primer, TOG906490_74_A04_106874754_Rev_VIC is an allele-specific reverse primer that detects SNP allele A, and TOG906490_74_A04_106874754_Rev_FAM is an allele-specific reverse primer that detects SNP allele C. The SNP is specifically a Single Nucleotide Polymorphism Kompetitive Allele Specific Polymerase Chain Reaction (SNP-KASP) marker. This marker is associated with the A. stenosperma-derived Root Knot Nematode resistance locus on linkage group A04 and was validated in a tetraploid context. TOG906490_74_A04_106874754 was developed using information taken from the A. duranensis genome sequence.
Sequenceunknown
Marker Positions
NameTOG906490_74_A04_106874754
Physical position(s)physical position unknown
Map Position(s)This marker is not placed on any map.