Trait: 

Rust, Puccinia

Trait Symbol: 
Leaf Rust
Page Contributors: 
PeanutBase (Jugpreet Singh)
Major Information Sources: 

Varshney, RajeevK., Pandey, ManishK., Janila, Pasupuleti, Nigam, ShyamN.,Sudini, Harikishan, Gowda, M.V.C., Sriswathi, Manda, Radhakrishnan, T., Manohar, SurendraS., Nagesh, Patne. Marker-assisted introgression of a QTL region to improve rust resistance in three elite and popular varieties of peanut (Arachis hypogaea L.). Theoretical and Applied Genetics (2014) 127(8):1771-1781. Get it

Suvendu Mondal, Poonam Hande, Anand M. Badigannavar. Identification of Transposable Element Markers for a Rust (Puccinia arachidis Speg.) Resistance Gene in Cultivated Peanut. Journal of Phytopathology (2014) 162: 548-552 Get it

IPAHM103   ♦ GM1536   ♦ GM2301   ♦ GM2079  

TE 360   ♦ TE 498  

SSR_GO340445   ♦ SSR_HO115759  

Backgrpound Information: 
Leaf rust, caused by Puccinia arachidis, is a wide-spread disease in peanut that leads to severe yield losses in almost all peanut growing countries. Together with late leaf spot, leaf rust causes signifcant decrease in productivity and fodder quality in peanut.
Trait Details: 

Trait synonyms: Fungal disease resistance, Leaf Rust (Puccinia arachidis Speg)

Peanut leaf rust is caused by Puccinia arachidis. The synonym terms used for this fungus are Bullaria arachidis (Speg.) Arthur & Mains, (1922) and Uromyces arachidis Henn., (1896) [Wikipedia as Source]. The term rust is used for both the disease and the causative fungus (Sillero et al., 2006).

The disease symptoms can be recognized by the appearance of orange pustules on the lower surface of the leaves. The rupturing of these pustules expose masses of reddish brown urediniospores which leads to the spread of infection to the neighboring plants. In highly susceptible genotypes, secondary pustules might surround the original pustules. Later, pustules may form on the upper surface corresponding to the position on the lower surface of leaf. These pustules develop on all the plant parts except flowers. Pustules are usually circular in shape that ranges from 0.5 to 1.4mm in diameter. Rust infection lead to dried and necrotic leaves which stay intact with the plant. The disease is usually spread through urediniospores by air, infected crop debris like surface contaminated pods, seeds or dried leaves. However, spread through seed borne pathogen or germplasm exchange is not evident. Leaf rust can cause infection to plants at any development age. Also, warm and humid weather can facilitate the spread of this fungus. Under favorable circumstances, leaf rust can spread to the entire field and can cause desiccation of all the plants. Early season rust infection may lead to significant yield losses as compared to late season rust epidemics (Sillero et al., 2006;Rashid & Bernier, 1991). In essence, severe disease infection can lead to approximately 50% of the yield losses.

image Smiley face

Markers for MAS: 
Markers (Varshney, Pandey et al., 2014) IPAHM103 GM1536 GM2301 GM2079    
source Varshney, Pandey et al., 2014 Varshney, Pandey et al., 2014 Varshney, Pandey et al., 2014 Varshney, Pandey et al., 2014    
comments "The marker-assisted backcrossing approach employed a total of four markers including one dominant (IPAHM103) and three co-dominant (GM2079, GM1536, GM2301) markers present in the QTL region". (Varshney, Pandey et al., 2014)          
type SSR          
Repeat NULL          
Forward primer GCATTCACCACCATAGTCCA AAAGCCCTGAAAAGAAAGCAG GTAACCACAGCTGGCATGAAC GGCCAAGGAGAAGAAGAAAGA    
Reverse primer TCCTCTGACTTTCCTCCATCA TATGCATTTGCAGGTTCTGGT TCTTCAAGAACCCACCAACAC GAAGGAGTAGTGGTGCTGCTG    
Size (bp) in resistance parent allele 154 473 127 416    
Size (bp) in suceptible parent allele 130 482 136 436    
Genotypes Accession (ICRISAT) Susceptibility aAllele Pedigree plant type Accession source
  ICGV91114 Suceptible A ICGV 86055' X 'ICGV 86533' Spanish Bunch ICRISAT
  GPBD4 Resistant B KRG 1' X 'CS 16' Spanish Bunch inter-specific hybridization
  TMV2 Suceptible A Mass Selection "Gudhiatham Bunch" Spanish Bunch ICRISAT
  RBC2F5R12_13 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_15 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_16 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_17 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_18 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_19 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_23 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_25 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_29 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_30 Resistant B Introgression line from 'ICGV 91114' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  JL24 Suceptible A Selection from 'EC 94943' Spanish Bunch Oilseeds Research Station, Jalgaon, Maharashtra (India)
  RBC2F5R12_45 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_46 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_78 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_87 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_88 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_97 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_138 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_139 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_140 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_143 Resistant B Introgression line from 'JL 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  TAG24 Suceptible A TGS2' X 'TGE1' Spanish Bunch Bhabha Atomic Research Center, Trombay (India)
  RBC2F5R12_103 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_104 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_107 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_108 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_114 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_117 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_118 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_129 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_130 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  RBC2F5R12_133 Resistant B Introgression line from 'TAG 24' X 'GPBD 4' Parental source 'Spanish Bunch' Marker-assisted backcrossing
  * Allele: A = allele present in the rust suceptible genotypes, and B = allele present in the rust resistant genotypes        
Marker 2 TE 360 TE 498        
source Mondal, Hande et al., 2013          
comments "Total of 40 TE primer pairs were found polymorphic between parents and two transposable element markers, and TE 360 and TE 498 were found associated with rust resistance gene. Based on genetic mapping, TE 360 was found linked to the rust resistance gene at 4.5 cM distance". (Mondal, Hande et al., 2013)          
type Transposable element markers          
Repeat AhMITE1-2          
Forward primer GGATATGATGCCCATAGCTGA ATGACTTACATGTAGCAATTG        
Reverse primer TGCTGACTACTTGCAATGCC TGAAAGGAGTCAAAGGTCATG        
Size (bp) of resistant parent allele approximately 450          
Size (bp) of suceptible parent allele approximately 200          
             
Genotypes Accession (ICRISAT) Susceptibility aAllele Pedigree plant type Accession source
  VG 9514 Resistant B CO 1' X 'A. cardenasii'    
  TAG 24 Suceptible A TGS2' X 'TGE1' Spanish Bunch Bhabha Atomic Research Center, Trombay (India)
  * Allele: A = allele present in the rust suceptible genotypes, and B = allele present in the rust resistant genotypes        

Marker 2 SSR_GO340445 SSR_HO115759          
source Mondel, Badigannavar et al., 2012b            
comments "Through genetic mapping, EST-SSR markers SSR_ GO340445 and SSR_HO115759 were found closely linked to a rust resistance gene at 1.9 and 3.8 cM distances, respectively." (Mondel, Badigannavar et al., 2012b)            
type SSR            
Repeat (TC)8 (GA)9          
Forward primer GGCGGCGGCTGAGGAAGAAG  TATCAACGCAACCTTTTGCAG          
Reverse primer ACGCGACGCAGAGTGAAAGAA  GACTTGTGTGGCTGAAACTTGA          
Size (bp) of resistant parent allele              
Size (bp) of suceptible parent allele              
               
Genotypes Accession (ICRISAT) Susceptibility aAllele Pedigree plant type Accession source Comment
  VG 9514 Resistant B A. cardenasii' X 'CO 1' NA NA Used for making cross
  GPBD 4 Resistant B KRG 1' X 'ICGV 86855' Spanish Bunch NA Used for original rust resistant screening
  FDS 272 Resistant B NA NA NA Used for original rust resistant screening
  NCAc 343 Resistant B NC bunch' X 'PI 1216067' NA NA Used for original rust resistant screening
  M 28-2 Resistant B EMS mutant of VL 1 NA NA Used for original rust resistant screening
  DTG 57 Resistant B TAG 24' X 'GPBD 4' NA NA Used for original rust resistant screening
  DTG 60 Resistant B TG 26' X 'M 28-2' NA NA Used for original rust resistant screening
  DTG 58 Resistant B TG 26' X 'M 28-2' NA NA Used for original rust resistant screening
  DTG 27 Resistant B TG 49' X 'B 37c' NA NA Used for original rust resistant screening
  TDG 56 Resistant B GPBD 4' X 'TG 49' NA NA Used for original rust resistant screening
  TFDRG 5 Resistant B TAG 24' X 'VG 9514' NA NA Used for original rust resistant screening
  TMV 2 Suceptible B Mass selection from "Gudhiatham bunch" Spanish Bunch NA Used for original rust resistant screening
  SB XI Suceptible B Selection from EC 94943 NA NA Used for original rust resistant screening
  JL24 Suceptible B Ah 4213' X 'Ah4354' Spanish Bunch NA Used for original rust resistant screening
  TAG 24 Suceptible A TGS2' X 'TGE1' Spanish Bunch Bhabha Atomic Research Center, Trombay (India) Used for making cross
  TG 37A Suceptible A TG 25' X 'TG 26' NA NA Used for original rust resistant screening
  TG 39 Suceptible A TAG 24' X 'TG 19' NA NA Used for original rust resistant screening
  TG 40 Suceptible A TAG 24' X 'TG 19' NA NA Used for original rust resistant screening
  TPG 41 Suceptible A TG 28A' X 'TG 22' NA NA Used for original rust resistant screening
  TG 42 Suceptible A TG 19' X ' TG 26' NA NA Used for original rust resistant screening
  * Allele: A = allele present in the rust suceptible genotypes, and B = allele present in the rust resistant genotypes            
  * Accessions "VG 9514" and "TAG 24" were used to generate recombinant inbred population. The remaining accessions were originally screened for rust resistance in "Mondal and Badigannavar, 2010".